cdna amd

cdna amd

The ARMS2 CRISPR guide RNA sequences shown above were designed at the Broad Institute* in order to efficiently target the ARMS2 gene with minimal risk of off-target Cas9 binding elsewhere in the genome. For complete details on the criteria and process for guide RNA design and selection.

  1. ARMS2 CRISPR Guide RNA or crRNA 1 ACCGATGGTAACTGAGGCGG
  2. ARMS2 CRISPR Guide RNA or crRNA 2 CCCTCCGCCTCAGTTACCAT
  3. ARMS2 CRISPR Guide RNA or crRNA 3 AGAATCACCTTGCTGCAGTG
  4. ARMS2 CRISPR Guide RNA or crRNA 4 CTATCATCCACACTGCAGCA
  5. ARMS2 CRISPR Guide RNA or crRNA 5 TACATGCTGCGCCTATACCC
  6. ARMS2 CRISPR Guide RNA or crRNA 6 CAGCACAGACTCTCGCAGAG

There are no products listed under this category.